crc-rna-seq-salmon

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

This report has been generated by the nf-core/rnaseq analysis pipeline. For information about how to interpret these results, please see the documentation.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2025-11-29, 18:47 CET based on data in: /tmp/nxf.zWS11fd0qN

General Statistics

Showing ¹²⁶/₁₂₆ rows and ¹¹/₁₈ columns.

Sample Name	% Aligned	M Aligned	Library types	CFR	M Bias	Dups	GC	Avg len	Median len	Failed	Seqs	Trimmed bases	Dups	GC	Avg len	Median len	Failed	Seqs
SRR17866817	92.2%	25.7M	ISR	100.0%	0.0
SRR17866817_1						65.3%	48.0%	57bp	57bp	18%	27.9M	1.2%	65.3%	48.0%	56bp	56bp	18%	27.9M
SRR17866817_2						60.8%	49.0%	57bp	57bp	18%	27.9M	1.4%	60.8%	49.0%	56bp	56bp	18%	27.9M
SRR17866818	93.5%	19.6M	ISR	100.0%	0.0
SRR17866818_1						67.4%	48.0%	57bp	57bp	18%	21.0M	1.2%	67.4%	48.0%	56bp	56bp	18%	21.0M
SRR17866818_2						63.3%	49.0%	57bp	57bp	18%	21.0M	1.5%	63.3%	49.0%	56bp	56bp	18%	21.0M
SRR17866819	91.5%	24.5M	ISR	100.0%	0.0
SRR17866819_1						65.3%	49.0%	57bp	57bp	18%	26.9M	1.2%	65.3%	49.0%	56bp	56bp	18%	26.8M
SRR17866819_2						62.8%	50.0%	57bp	57bp	18%	26.9M	1.4%	62.8%	50.0%	56bp	56bp	18%	26.8M
SRR17866820	90.5%	26.4M	ISR	100.0%	0.0
SRR17866820_1						69.4%	49.0%	57bp	57bp	18%	29.2M	1.2%	69.4%	49.0%	56bp	56bp	18%	29.2M
SRR17866820_2						66.6%	50.0%	57bp	57bp	18%	29.2M	1.5%	66.6%	49.0%	56bp	56bp	18%	29.2M
SRR17866821	94.5%	24.9M	ISR	100.0%	0.0
SRR17866821_1						68.9%	48.0%	57bp	57bp	18%	26.4M	1.2%	68.9%	48.0%	56bp	56bp	18%	26.3M
SRR17866821_2						70.5%	50.0%	57bp	57bp	27%	26.4M	1.4%	70.5%	49.0%	56bp	56bp	27%	26.3M
SRR17866822	93.6%	21.8M	ISR	100.0%	0.0
SRR17866822_1						67.9%	48.0%	57bp	57bp	18%	23.3M	1.2%	67.9%	48.0%	56bp	56bp	18%	23.3M
SRR17866822_2						68.1%	49.0%	57bp	57bp	27%	23.3M	1.4%	68.1%	49.0%	56bp	56bp	27%	23.3M
SRR17866823	94.9%	31.2M	ISR	100.0%	0.0
SRR17866823_1						71.0%	48.0%	57bp	57bp	18%	32.9M	1.4%	70.9%	48.0%	56bp	56bp	18%	32.8M
SRR17866823_2						68.7%	50.0%	57bp	57bp	27%	32.9M	1.5%	68.7%	49.0%	56bp	56bp	27%	32.8M
SRR17866824	92.3%	29.9M	ISR	100.0%	0.0
SRR17866824_1						70.3%	49.0%	57bp	57bp	18%	32.4M	1.2%	70.2%	49.0%	56bp	56bp	18%	32.4M
SRR17866824_2						67.7%	50.0%	57bp	57bp	27%	32.4M	1.6%	67.7%	50.0%	56bp	56bp	27%	32.4M
SRR17866825	92.7%	24.7M	ISR	100.0%	0.0
SRR17866825_1						64.2%	48.0%	57bp	57bp	18%	26.7M	1.2%	64.2%	48.0%	56bp	56bp	18%	26.7M
SRR17866825_2						63.7%	49.0%	57bp	57bp	18%	26.7M	1.4%	63.7%	49.0%	56bp	56bp	27%	26.7M
SRR17866826	93.4%	28.0M	ISR	100.0%	0.0
SRR17866826_1						72.0%	48.0%	57bp	57bp	18%	30.0M	1.1%	71.9%	48.0%	56bp	56bp	18%	30.0M
SRR17866826_2						69.2%	49.0%	57bp	57bp	18%	30.0M	1.5%	69.2%	48.0%	56bp	56bp	18%	30.0M
SRR17866827	89.3%	24.8M	ISR	100.0%	0.0
SRR17866827_1						61.8%	49.0%	57bp	57bp	18%	27.8M	1.2%	61.7%	49.0%	56bp	56bp	18%	27.8M
SRR17866827_2						58.8%	50.0%	57bp	57bp	18%	27.8M	1.5%	58.8%	50.0%	56bp	56bp	18%	27.8M
SRR17866828	94.1%	33.9M	ISR	100.0%	0.0
SRR17866828_1						71.9%	49.0%	57bp	57bp	18%	36.1M	1.2%	71.9%	49.0%	56bp	56bp	18%	36.0M
SRR17866828_2						71.7%	50.0%	57bp	57bp	27%	36.1M	1.5%	71.7%	50.0%	56bp	56bp	27%	36.0M
SRR17866829	92.1%	28.6M	ISR	100.0%	0.0
SRR17866829_1						67.9%	49.0%	57bp	57bp	18%	31.1M	1.2%	67.9%	49.0%	56bp	56bp	18%	31.0M
SRR17866829_2						64.9%	50.0%	57bp	57bp	18%	31.1M	1.5%	64.9%	49.0%	56bp	56bp	18%	31.0M
SRR17866830	93.9%	33.5M	ISR	100.0%	0.0
SRR17866830_1						76.2%	48.0%	57bp	57bp	18%	35.8M	1.1%	76.2%	47.0%	56bp	56bp	18%	35.7M
SRR17866830_2						73.6%	49.0%	57bp	57bp	18%	35.8M	1.5%	73.6%	48.0%	56bp	56bp	18%	35.7M
SRR17866831	93.1%	31.7M	ISR	100.0%	0.0
SRR17866831_1						75.1%	48.0%	57bp	57bp	18%	34.0M	1.1%	75.1%	47.0%	56bp	56bp	18%	34.0M
SRR17866831_2						73.4%	49.0%	57bp	57bp	27%	34.0M	1.5%	73.4%	48.0%	56bp	56bp	27%	34.0M
SRR17866832	88.7%	27.5M	ISR	100.0%	0.0
SRR17866832_1						70.1%	49.0%	57bp	57bp	18%	31.0M	1.1%	70.1%	48.0%	56bp	56bp	18%	31.0M
SRR17866832_2						67.1%	49.0%	57bp	57bp	18%	31.0M	1.4%	67.2%	49.0%	56bp	56bp	18%	31.0M
SRR17866833	93.7%	32.6M	ISR	100.0%	0.0
SRR17866833_1						63.5%	49.0%	57bp	57bp	18%	34.8M	1.3%	63.5%	49.0%	56bp	56bp	18%	34.8M
SRR17866833_2						63.8%	51.0%	57bp	57bp	18%	34.8M	1.4%	63.9%	50.0%	56bp	56bp	18%	34.8M
SRR17866834	94.2%	33.1M	ISR	100.0%	0.0
SRR17866834_1						71.2%	49.0%	57bp	57bp	18%	35.2M	1.2%	71.1%	49.0%	56bp	56bp	18%	35.1M
SRR17866834_2						67.9%	50.0%	57bp	57bp	18%	35.2M	1.6%	67.9%	49.0%	56bp	56bp	18%	35.1M
SRR17866835	93.6%	78.9M	ISR	100.0%	0.0
SRR17866835_1						77.8%	48.0%	57bp	57bp	18%	84.5M	1.1%	77.8%	47.0%	56bp	56bp	18%	84.3M
SRR17866835_2						77.4%	48.0%	57bp	57bp	27%	84.5M	1.5%	77.4%	48.0%	56bp	56bp	27%	84.3M
SRR17866836	93.6%	24.8M	ISR	100.0%	0.0
SRR17866836_1						68.8%	48.0%	57bp	57bp	18%	26.5M	1.2%	68.8%	48.0%	56bp	56bp	18%	26.4M
SRR17866836_2						66.1%	49.0%	57bp	57bp	27%	26.5M	1.4%	66.1%	49.0%	56bp	56bp	27%	26.4M
SRR17866837	95.2%	27.4M	ISR	100.0%	0.0
SRR17866837_1						69.0%	48.0%	57bp	57bp	18%	28.8M	1.2%	69.0%	47.0%	56bp	56bp	18%	28.8M
SRR17866837_2						66.4%	49.0%	57bp	57bp	27%	28.8M	1.4%	66.4%	48.0%	56bp	56bp	27%	28.8M
SRR17866838	93.9%	36.9M	ISR	100.0%	0.0
SRR17866838_1						72.1%	50.0%	57bp	57bp	18%	39.3M	1.2%	72.1%	49.0%	56bp	56bp	18%	39.3M
SRR17866838_2						70.9%	51.0%	57bp	57bp	18%	39.3M	1.5%	70.9%	50.0%	56bp	56bp	18%	39.3M
SRR17866839	94.0%	26.5M	ISR	100.0%	0.0
SRR17866839_1						70.7%	49.0%	57bp	57bp	18%	28.2M	1.2%	70.7%	49.0%	56bp	56bp	18%	28.1M
SRR17866839_2						67.1%	50.0%	57bp	57bp	18%	28.2M	1.4%	67.1%	50.0%	56bp	56bp	18%	28.1M
SRR17866840	93.4%	29.5M	ISR	100.0%	0.0
SRR17866840_1						70.8%	48.0%	57bp	57bp	18%	31.6M	1.2%	70.8%	48.0%	56bp	56bp	18%	31.6M
SRR17866840_2						67.4%	49.0%	57bp	57bp	18%	31.6M	1.5%	67.4%	49.0%	56bp	56bp	18%	31.6M
SRR17866841	90.2%	27.3M	ISR	100.0%	0.0
SRR17866841_1						65.1%	48.0%	57bp	57bp	18%	30.3M	1.2%	65.0%	48.0%	56bp	56bp	18%	30.3M
SRR17866841_2						62.1%	49.0%	57bp	57bp	18%	30.3M	1.4%	62.1%	49.0%	56bp	56bp	18%	30.3M
SRR17866842	90.2%	22.2M	ISR	100.0%	0.0
SRR17866842_1						68.1%	48.0%	57bp	57bp	18%	24.6M	1.2%	68.1%	48.0%	56bp	56bp	18%	24.6M
SRR17866842_2						69.3%	49.0%	57bp	57bp	27%	24.6M	1.4%	69.3%	49.0%	56bp	56bp	27%	24.6M
SRR17866843	93.9%	37.4M	ISR	100.0%	0.0
SRR17866843_1						74.3%	51.0%	57bp	57bp	18%	39.9M	1.3%	74.2%	51.0%	56bp	56bp	18%	39.8M
SRR17866843_2						72.1%	52.0%	57bp	57bp	27%	39.9M	1.5%	72.1%	52.0%	56bp	56bp	27%	39.8M
SRR17866844	91.4%	29.7M	ISR	100.0%	0.0
SRR17866844_1						72.8%	51.0%	57bp	57bp	18%	32.8M	1.8%	72.6%	50.0%	56bp	56bp	18%	32.5M
SRR17866844_2						70.7%	52.0%	57bp	57bp	27%	32.8M	2.1%	70.5%	51.0%	56bp	56bp	27%	32.5M
SRR17866845	93.3%	24.4M	ISR	100.0%	0.0
SRR17866845_1						69.0%	49.0%	57bp	57bp	18%	26.2M	1.3%	68.9%	49.0%	56bp	56bp	18%	26.1M
SRR17866845_2						67.3%	50.0%	57bp	57bp	18%	26.2M	1.6%	67.3%	50.0%	56bp	56bp	18%	26.1M
SRR17866846	93.4%	31.2M	ISR	100.0%	0.0
SRR17866846_1						70.8%	50.0%	57bp	57bp	18%	33.5M	1.3%	70.7%	49.0%	56bp	56bp	18%	33.4M
SRR17866846_2						68.8%	51.0%	57bp	57bp	18%	33.5M	1.6%	68.8%	50.0%	56bp	56bp	18%	33.4M
SRR17866847	89.3%	25.6M	ISR	100.0%	0.0
SRR17866847_1						66.4%	50.0%	57bp	57bp	18%	28.8M	1.3%	66.4%	50.0%	56bp	56bp	18%	28.7M
SRR17866847_2						64.5%	51.0%	57bp	57bp	18%	28.8M	1.6%	64.5%	50.0%	56bp	56bp	18%	28.7M
SRR17866848	93.7%	32.1M	ISR	100.0%	0.0
SRR17866848_1						69.5%	50.0%	57bp	57bp	18%	34.3M	1.3%	69.5%	49.0%	56bp	56bp	18%	34.2M
SRR17866848_2						66.5%	51.0%	57bp	57bp	18%	34.3M	1.5%	66.5%	50.0%	56bp	56bp	18%	34.2M
SRR17866849	92.8%	34.0M	ISR	100.0%	0.0
SRR17866849_1						65.4%	49.0%	57bp	57bp	18%	36.7M	1.3%	65.4%	49.0%	56bp	56bp	18%	36.7M
SRR17866849_2						61.9%	50.0%	57bp	57bp	18%	36.7M	1.5%	61.9%	50.0%	56bp	56bp	18%	36.7M
SRR17866850	93.1%	25.0M	ISR	100.0%	0.0
SRR17866850_1						74.5%	51.0%	57bp	57bp	18%	27.0M	1.7%	74.4%	50.0%	56bp	56bp	18%	26.8M
SRR17866850_2						72.4%	51.0%	57bp	57bp	18%	27.0M	2.0%	72.3%	51.0%	56bp	56bp	18%	26.8M
SRR17866851	83.7%	29.1M	ISR	100.0%	0.0
SRR17866851_1						70.2%	50.0%	57bp	57bp	18%	34.7M	1.2%	70.2%	50.0%	56bp	56bp	18%	34.7M
SRR17866851_2						66.3%	51.0%	57bp	57bp	18%	34.7M	1.4%	66.3%	51.0%	56bp	56bp	18%	34.7M
SRR17866852	86.2%	24.3M	ISR	100.0%	0.0
SRR17866852_1						65.0%	51.0%	57bp	57bp	27%	28.2M	1.3%	65.0%	50.0%	56bp	56bp	27%	28.2M
SRR17866852_2						62.7%	52.0%	57bp	57bp	36%	28.2M	1.4%	62.7%	51.0%	56bp	56bp	36%	28.2M
SRR17866853	94.3%	28.6M	ISR	100.0%	0.0
SRR17866853_1						80.9%	47.0%	57bp	57bp	18%	30.4M	1.1%	80.9%	47.0%	56bp	56bp	18%	30.3M
SRR17866853_2						78.1%	48.0%	57bp	57bp	18%	30.4M	1.5%	78.1%	48.0%	56bp	56bp	18%	30.3M
SRR17866854	86.6%	29.9M	ISR	100.0%	0.0
SRR17866854_1						71.5%	49.0%	151bp	151bp	27%	34.6M	12.0%	71.4%	49.0%	133bp	142bp	18%	34.5M
SRR17866854_2						71.0%	49.0%	151bp	151bp	27%	34.6M	12.2%	70.9%	49.0%	133bp	142bp	18%	34.5M
SRR17866855	78.8%	25.5M	ISR	100.0%	0.0
SRR17866855_1						85.0%	50.0%	57bp	57bp	18%	32.5M	1.4%	84.9%	50.0%	56bp	56bp	18%	32.4M
SRR17866855_2						82.8%	52.0%	57bp	57bp	18%	32.5M	1.6%	82.8%	51.0%	56bp	56bp	18%	32.4M
SRR17866856	94.4%	25.0M	ISR	100.0%	0.0
SRR17866856_1						70.4%	49.0%	57bp	57bp	18%	26.6M	1.2%	70.4%	48.0%	56bp	56bp	18%	26.5M
SRR17866856_2						68.6%	50.0%	57bp	57bp	18%	26.6M	1.5%	68.6%	49.0%	56bp	56bp	18%	26.5M
SRR17866857	95.1%	29.7M	ISR	100.0%	0.0
SRR17866857_1						73.5%	49.0%	57bp	57bp	18%	31.3M	1.4%	73.4%	48.0%	56bp	56bp	18%	31.2M
SRR17866857_2						69.3%	50.0%	57bp	57bp	18%	31.3M	1.6%	69.3%	50.0%	56bp	56bp	18%	31.2M
SRR17866858	94.5%	29.6M	ISR	100.0%	0.0
SRR17866858_1						71.6%	50.0%	57bp	57bp	18%	31.3M	1.3%	71.6%	49.0%	56bp	56bp	18%	31.3M
SRR17866858_2						68.6%	51.0%	57bp	57bp	27%	31.3M	1.6%	68.6%	50.0%	56bp	56bp	27%	31.3M

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table_table

Sort	Group	Column	Description	ID	Scale
\|\|	Salmon	% Aligned	% Mapped reads	`salmon-percent_mapped`
\|\|	Salmon	M Aligned	Mapped reads (millions)	`salmon-num_mapped`	read_count
\|\|	Salmon	Library types	Library types	`salmon-library_types`
\|\|	Salmon	CFR	Compatible fragment ratio	`salmon-compatible_fragment_ratio`
\|\|	Salmon	M Bias	Strand mapping bias	`salmon-strand_mapping_bias`
\|\|	FastQC (raw)	Dups	% duplicate reads	`fastqc_raw-percent_duplicates`
\|\|	FastQC (raw)	GC	Average % GC content	`fastqc_raw-percent_gc`
\|\|	FastQC (raw)	Avg len	Average read length	`fastqc_raw-avg_sequence_length`
\|\|	FastQC (raw)	Median len	Median read length	`fastqc_raw-median_sequence_length`
\|\|	FastQC (raw)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_raw-percent_fails`
\|\|	FastQC (raw)	Seqs	Total sequences (millions)	`fastqc_raw-total_sequences`	read_count
\|\|	Cutadapt	Trimmed bases	% total base pairs trimmed	`cutadapt-percent_trimmed`
\|\|	FastQC (trimmed)	Dups	% duplicate reads	`fastqc_trimmed-percent_duplicates`
\|\|	FastQC (trimmed)	GC	Average % GC content	`fastqc_trimmed-percent_gc`
\|\|	FastQC (trimmed)	Avg len	Average read length	`fastqc_trimmed-avg_sequence_length`
\|\|	FastQC (trimmed)	Median len	Median read length	`fastqc_trimmed-median_sequence_length`
\|\|	FastQC (trimmed)	Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`fastqc_trimmed-percent_fails`
\|\|	FastQC (trimmed)	Seqs	Total sequences (millions)	`fastqc_trimmed-total_sequences`	read_count

FastQC (raw)

This section of the report shows FastQC results before adapter trimming.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (e.g. PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

84 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
TCCCGTATCGAAGGCCTTTTTGGACAGGTGGTGTGTGGTGGCCTTGGTAT	17	688207	0.0256%
TCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGC	10	407889	0.0152%
ACTGTCTCTTATACACATCTGACGCTGCCGACGAACGTTCCTTAGTGTAG	1	172094	0.0064%
TCCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTC	2	137731	0.0051%
TCTGTCTCTTATACACATCTCCGAGCCCACGAGACACGCCTTGTTATCTC	1	125482	0.0047%
ACTGTCTCTTATACACATCTGACGCTGCCGACGATGGTAGAGATGTGTAG	1	123555	0.0046%
TCTGTCTCTTATACACATCTCCGAGCCCACGAGACAGATCCATTAATCTC	1	95043	0.0035%
TCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAA	1	64728	0.0024%
CTGTCTCTTATACACATCTGACGCTGCCGACGACCTTCTAACAGTGTAGA	1	53743	0.0020%
TCTGTCTCTTATACACATCTCCGAGCCCACGAGACACGCCTTGTTATCGC	1	46672	0.0017%
TGTGAAAGATGAGCTGGAGGACCGCAATAGGGGTAGGTCCCCTGTGGAAA	1	45884	0.0017%
TCTGTCTCTTATACACATCTCCGAGCCCACGAGACTATTGCGCTCATCTC	1	44268	0.0016%
ACTGTCTCTTATACACATCTGACGCTGCCGACGAAATATTGCCAGTGTAG	1	39868	0.0015%
ACTGTCTCTTATACACATCTGACGCTGCCGACGATTCAGTTGTCGTGTAG	1	39793	0.0015%
CTGTCTCTTATACACATCTCCGAGCCCACGAGACTTCATAAGGTATCTCG	1	35901	0.0013%
TGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAG	1	34165	0.0013%
TGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCGGC	1	33916	0.0013%
TGGGGGCTTCAATCGGGAGTACTACTCGATTGTCAACGTCAAGGAGTCGC	1	30514	0.0011%
TCTGTCTCTTATACACATCTCCGAGCCCACGAGACAGATCCATTAATCGC	1	30275	0.0011%
ACTGTCTCTTATACACATCTGACGCTGCCGACGACGCGGTGATCGTGTAG	1	28987	0.0011%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_raw_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_raw-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_raw-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_raw-total_percent`

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Created with MultiQC

Cutadapt

Finds and removes adapter sequences, primers, poly-A tails, and other types of unwanted sequences.URL: https://cutadapt.readthedocs.ioDOI: 10.14806/ej.17.1.200

Filtered Reads

This plot shows the number of reads (SE) / pairs (PE) removed by Cutadapt.

Created with MultiQC

Trimmed Sequence Lengths (3')

This plot shows the number of reads with certain lengths of adapter trimmed for the 3' end.

Obs/Exp shows the raw counts divided by the number expected due to sequencing errors. A defined peak may be related to adapter length.

See the cutadapt documentation for more information on how these numbers are generated.

Created with MultiQC

FastQC (trimmed)

This section of the report shows FastQC results after adapter trimming.URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

Created with MultiQC

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

Created with MultiQC

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

Created with MultiQC

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

Created with MultiQC

Sequence Length Distribution

The distribution of fragment sizes (read lengths) found. See the FastQC help

Created with MultiQC

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Created with MultiQC

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

From the FastQC Help:

84 samples had less than 1% of reads made up of overrepresented sequences

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ⁸/₈ rows and ³/₃ columns.

Overrepresented sequence	Reports	Occurrences	% of all reads
TCCCGTATCGAAGGCCTTTTTGGACAGGTGGTGTGTGGTGGCCTTGGTAT	17	687970	0.0256%
TCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGC	10	407874	0.0152%
TCCTCACCCGGCCCGGACACGGACAGGATTGACAGATTGATAGCTCTTTC	2	137726	0.0051%
TCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAA	1	64727	0.0024%
TGTGAAAGATGAGCTGGAGGACCGCAATAGGGGTAGGTCCCCTGTGGAAA	1	45869	0.0017%
TGTCGGCATGTATTAGCTCTAGAATTACCACAGTTATCCAAGTAGGAGAG	1	34145	0.0013%
TGGCAGACGTTCGAATGGGTCGTCGCCGCCACGGGGGGCGTGCGATCGGC	1	33911	0.0013%
TGGGGGCTTCAATCGGGAGTACTACTCGATTGTCAACGTCAAGGAGTCGC	1	30502	0.0011%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_trimmed_top_overrepresented_sequences_table_table

Sort	Column	Description	ID
\|\|	Reports	Number of FastQC reports where this sequence is founds as overrepresented	`fastqc_trimmed-samples`
\|\|	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`fastqc_trimmed-total_count`
\|\|	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`fastqc_trimmed-total_percent`

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

Created with MultiQC

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

Created with MultiQC

Salmon

Quantifies expression of transcripts using RNA-seq data.URL: https://combine-lab.github.io/salmonDOI: 10.1038/nmeth.4197

Created with MultiQC

Sample relationships

Plots interrogating sample relationships, based on final count matrices.

SALMON DESeq2 sample similarity

is generated from clustering by Euclidean distances between DESeq2 rlog values for each sample in the deseq2_qc.r script.

Created with MultiQC

SALMON DESeq2 PCA plot

PCA plot between samples in the experiment. These values are calculated using DESeq2 in the deseq2_qc.r script.

Created with MultiQC

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Group	Software	Version
CUSTOM_GETCHROMSIZES	getchromsizes	`1.21`
CUSTOM_TX2GENE	python	`3.10.4`
DESEQ2_QC_PSEUDO	bioconductor-deseq2	`1.28.0`
	r-base	`4.0.3`
FASTQC	fastqc	`0.12.1`
FQ_LINT	fq	`0.12.0 (2024-07-08)`
FQ_SUBSAMPLE	fq	`0.12.0 (2024-07-08)`
GTF2BED	perl	`5.26.2`
GTF_FILTER	python	`3.9.5`
GUNZIP_FASTA	gunzip	`1.13`
GUNZIP_GTF	gunzip	`1.13`
MAKE_TRANSCRIPTS_FASTA	rsem	`1.3.1`
	star	`2.7.10a`
SALMON_QUANT	salmon	`1.10.3`
SE_GENE_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
SE_TRANSCRIPT_UNIFIED	bioconductor-summarizedexperiment	`1.32.0`
TRIMGALORE	cutadapt	`4.9`
	pigz	`2.8`
	trimgalore	`0.6.10`
TXIMETA_TXIMPORT	bioconductor-tximeta	`1.20.1`
Workflow	Nextflow	`25.04.6`
	nf-core/rnaseq	`v3.21.0-g9738a2d`

nf-core/rnaseq Methods Description

Suggested text and references to use when describing pipeline usage within the methods section of a publication.URL: https://github.com/nf-core/rnaseq

Methods

Data was processed using nf-core/rnaseq v3.21.0 (doi: 10.5281/zenodo.1400710) of the nf-core collection of workflows (Ewels et al., 2020), utilising reproducible software environments from the Bioconda (Grüning et al., 2018) and Biocontainers (da Veiga Leprevost et al., 2017) projects.

The pipeline was executed with Nextflow v25.04.6 (Di Tommaso et al., 2017) with the following command:

nextflow run nf-core/rnaseq -profile unavcluster -params-file params_rnaseq.yaml -c hpc.config

References

Di Tommaso, P., Chatzou, M., Floden, E. W., Barja, P. P., Palumbo, E., & Notredame, C. (2017). Nextflow enables reproducible computational workflows. Nature Biotechnology, 35(4), 316-319. doi: 10.1038/nbt.3820
Ewels, P. A., Peltzer, A., Fillinger, S., Patel, H., Alneberg, J., Wilm, A., Garcia, M. U., Di Tommaso, P., & Nahnsen, S. (2020). The nf-core framework for community-curated bioinformatics pipelines. Nature Biotechnology, 38(3), 276-278. doi: 10.1038/s41587-020-0439-x
Grüning, B., Dale, R., Sjödin, A., Chapman, B. A., Rowe, J., Tomkins-Tinch, C. H., Valieris, R., Köster, J., & Bioconda Team. (2018). Bioconda: sustainable and comprehensive software distribution for the life sciences. Nature Methods, 15(7), 475–476. doi: 10.1038/s41592-018-0046-7
da Veiga Leprevost, F., Grüning, B. A., Alves Aflitos, S., Röst, H. L., Uszkoreit, J., Barsnes, H., Vaudel, M., Moreno, P., Gatto, L., Weber, J., Bai, M., Jimenez, R. C., Sachsenberg, T., Pfeuffer, J., Vera Alvarez, R., Griss, J., Nesvizhskii, A. I., & Perez-Riverol, Y. (2017). BioContainers: an open-source and community-driven framework for software standardization. Bioinformatics (Oxford, England), 33(16), 2580–2582. doi: 10.1093/bioinformatics/btx192

Notes:

The command above does not include parameters contained in any configs or profiles that may have been used. Ensure the config file is also uploaded with your publication!
You should also cite all software used within this run. Check the "Software Versions" of this report to get version information.

nf-core/rnaseq Workflow Summary

this information is collected when the pipeline is started.URL: https://github.com/nf-core/rnaseq

Input/output options

input: samplesheet_eocrc.csv
multiqc_title: crc-rna-seq-salmon
outdir: results

Reference genome options

fasta: data/genomes/GRCh38/GRCh38.primary_assembly.genome.fa.gz
gencode: true
gtf: data/genomes/GRCh38/gencode.v49.primary_assembly.annotation.gtf.gz
igenomes_ignore: true
salmon_index: data/genomes/GRCh38/genome_gencode/index/salmon

UMI options

umi_discard_read: 0

Alignment options

pseudo_aligner: salmon

Process skipping options

skip_alignment: true

Generic options

trace_report_suffix: 2025-11-29_16-24-20

Core Nextflow options

configFiles: /home/samarquez/.nextflow/assets/nf-core/rnaseq/nextflow.config, /beegfs/home/samarquez/tfm-rnaseq/master-bioinformatics/nextflow-pipelines/nf-core-rnaseq/nf-core-rnaseq-salmon-pe/hpc.config
containerEngine: singularity
launchDir: /beegfs/home/samarquez/tfm-rnaseq/master-bioinformatics/nextflow-pipelines/nf-core-rnaseq/nf-core-rnaseq-salmon-pe
profile: unavcluster
projectDir: /home/samarquez/.nextflow/assets/nf-core/rnaseq
revision: master
runName: festering_poitras
userName: samarquez
workDir: /beegfs/home/samarquez/tfm-rnaseq/master-bioinformatics/nextflow-pipelines/nf-core-rnaseq/nf-core-rnaseq-salmon-pe/work

Toggle navigation v1.31

crc-rna-seq-salmon

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Explain with AI

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

crc-rna-seq-salmon

General Statistics

General Statistics: Columns

FastQC (raw)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Cutadapt

Filtered Reads

Trimmed Sequence Lengths (3') Help

FastQC (trimmed)

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Salmon

Sample relationships

SALMON DESeq2 sample similarity

SALMON DESeq2 PCA plot

Software Versions

nf-core/rnaseq Methods Description

Methods

References

Notes:

nf-core/rnaseq Workflow Summary

v1.31

Highlight Samples

Rename Samples

Show / Hide Samples

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks

Trimmed Sequence Lengths (3')

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks